Table 1 Assay design for qRT-PCR analysis of gene expression in ACL tissue or EBV LCLs
Gene symbol—probe name | Gene | Amplicon position | UPL probe # | Left primera | Right primerb |
|---|---|---|---|---|---|
CEP57L1—exons 4-5 | Centrosomal protein 57 kDa-like 1 | Spans exons 4 and 5 of human CEP57L1 transcript variant 1 | 78 | agcccaaatagccaagctc | tctctggaaagaatgttcaggtt |
CEP57L1—exons 5-6 | Centrosomal protein 57 kDa-like 1 | Spans exons 5 and 6 of human CEP57L1 transcript variant 1 | 17 | caaatgagagaaatctggcaca | acgagactgggctgagctt |
CEP57L1—exon 1 | Centrosomal protein 57 kDa-like 1 | Contained within exon 1 of human CEP57L1 transcript variant 1 | 80 | ctaagcttgcgccctgag | cgaagtctcagtgtacttctacgtct |
ACTB | Beta-actin | Spans exons 4 and 5 of human ACTB transcript | 11 | attggcaatgagcggttc | cgtggatgccacaggact |
B2M | Beta-2-microglobulin | Spans exons 1 and 2 of human B2M transcript | 42 | ttctggcctggaggctatc | tcaggaaatttgactttccattc |
G6PD | Glucose-6-phosphate dehydrogenase | Spans exons 4 and 5 of human G6PD transcript | 82 | Gcaaacagagtgagcccttc | gagttgcgggcaaagaagt |