Whole exome sequencing of a single osteosarcoma case—integrative analysis with whole transcriptome RNA-seq data

Table 7 The integrative analysis—genes with altered expression pattern [10] and SNVs annotated with ANNOVAR software

Gene name	Transcript name—exon number: nucleotide change/amino acid change	ljb2 score/indel	Chr number	Start	End	REF/ALT	logFC	FDR
Germline mutations homozygous in tumour tissue
STEAP4	NM_024636—exon2: c.G364A/p.A122T	0.647	Chr7	87913221	87913221	C/T	3.015	1.44E-19
	NM_001205316—exon2: c.G364A/p.A122T
	NM_001205315—exon3: c.G364A/p.A122T
DDX60L	NM_001012967—exon18: c.T2491C/p.C831R	0.711	Chr4	169341435	169341435	A/G	2.349	2.67E-14
MT1A	NM_005946—exon3: c.A152G/p.K51R	0.785	Chr16	56673828	56673828	A/G	−3.094	0.00795
ACOX1	NM_004035—exon7: c.C936G/p.I312M	0.872	Chr17	73949540	73949540	G/C	−0.809	0.01538
	NM_007292—exon7: c.C936G/p.I312M
	NM_001185039—exon7: c.C822G/p.I274M
TMC7	NM_001160364—exon6: c.G431A/p.G144E	0.695	Chr16	19041595	19041595	G/A	1.266	0.01726
TMC7	NM_024847—exon6: c.G761A/p.G254E	0.695	Chr16	19041595	19041595	G/A	1.266	0.01726
MYO7A	NM_001127179—exon27: c.3514_3535del/p.1172_1179del	Frameshift deletion	Chr11	76895771	76895792	GGAGGCGGGGACACCAGGGCCT/-	1.541	0.03810
ATRNL1	NM_001276282—exon8: c.1399_1400insTT/p.L467fs	Frameshift insertion	Chr10	116931101	116931101	-/TT	2.321	0.04535
Somatic mutations homozygous in the tumour tissue
TMEM120B	NM_001080825—exon3: c.G274A/p.D92N → X → COSM1599921	0.981	Chr12	122186317	122186317	G/A	−1.548	0.00064
TMEM131	NM_015348—exon31: c.C3947T/p.P1316L	0.945	Chr2	98409046	98409046	G/A	−0.799	0.01371
EI24	NM_001007277—exon9: c.733dupC/p.R244fs	Frameshift insertion	Chr11	125452300	125452300	-/C	−0.815	0.01569

These germline or somatic SNVs are all nonsynonymous and homozygous in the tumour tissue and according to ljb2 database have a disease-causing effect.

ISSN: 1479-7364