Skip to main content

Table 1 Primer sequences and reaction conditions used for PCR

From: Mutational analysis of epidermal and hyperproliferative type I keratins in mild and moderate psoriasis vulgaris patients: a possible role in the pathogenesis of psoriasis along with disease severity

S. no. Primer Sequences (5′-3′) Length (bp) Reaction conditions
1 K14 F GTGGGCAGTGAGAAGGTGAC 966 Denaturation, 30 s at 94 °C
Annealing, 45 s at 59 °C
Extension, 60 s at 72 °C
No. of cycles, 35
  K14 R AGAGGAGAACTGGGAGGAGG
2 K10 F GGCTCATCAGGTGGCTAT 812 Denaturation, 30 s at 94 °C
Annealing, 45 s at 58 °C
Extension, 60 s at 72 °C
No. of cycles, 35
  K10 R CAGGCTTCAGCATCTTTG
3 K16 F GTGAAGATCCGTGACTGG 856 Denaturation, 30 s at 94 °C
Annealing, 45 s at 56 °C
Extension,60 s at 72 °C
No. of cycles, 35
  K16 R TGCTGGGAGGAAAGGTGG
4 K17 F CTTCCGCACCAAGTTTGA 753 Denaturation, 30 s at 94 °C
Annealing, 45 s at 55 °C
Extension, 60 s at 72 °C
No. of cycles, 35
  K17 R TTGCCATCCTGGACCTCT