Skip to main content

Advertisement

Table 3 Sequences of the primers used for real-time quantitative PCR

From: Identification of TBX2 and TBX3 variants in patients with conotruncal heart defects by target sequencing

Gene Forward (5′→3′) Reverse (5′→3′)
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG
TBX2 CACGGCTTCACCATCCTAAAC TGCGGAAGGTGCTGTAAGG
TBX3 GAGGCTAAAGAACTTTGGGATCA CATTTCGGGGTCGGCCTTA
BMP2 GAGGTCCTGAGCGAGTTCGA ACCTGAGTGCCTGCGATACA
BMP4 ATGATTCCTGGTAACCGAATGC CCCCGTCTCAGGTATCAAACT
CRELD1 GCTCCTATGAGTGCCGAGAC CTACACTTCTTACAGCGACCTG
DKK1 ATAGCACCTTGGATGGGTATTCC CTGATGACCGGAGACAAACAG
FGF8 GACCCCTTCGCAAAGCTCAT CCGTTGCTCTTGGCGATCA
FOG2 GGCCTGAAAATCTGAGCTGC CAGTCGTCTGTCTCAACTCCA
GATA4 CGACACCCCAATCTCGATATG GTTGCACAGATAGTGACCCGT
GATA6 CTCAGTTCCTACGCTTCGCAT GTCGAGGTCAGTGAACAGCA
HAND2 CGCCGACACCAAACTCTCC TCGCCATTCTGGTCGTCCT
HAS2 CTCATCATCCAAAGCCTGTT GCTGGGTCAAGCATAGTGTC
MEF2C CCAACTTCGAGATGCCAGTCT GTCGATGTGTTACACCAGGAG
PLXND1 AATGGGCGGAACATCGTCAAG CGAGACTGGTTGGAAACACAG
PEA3 GAGAAACCTCTGCGACCATT GCCCGTCCAGGCAATGAAAT