Skip to main content

Table 3 Pyrosequencing and qPCR primer sets

From: Impact of ZBTB7A hypomethylation and expression patterns on treatment response to hydroxyurea

Gene CpG islands Sequence Primers
BCL11A CpG 120 5′ GTTGTTTTGGAGTGGGAG 3′ Forward
5′ CAAATTAAAAACTAAACCTCCAAATTAC 3′ Reverse 5′-biotin labeled
5′ TTTTTTTTTTGAGATTTTTAGGAGT 3′ Forward/Pyrosequencing
5′ATTACTCCCCAACACCCTCCT 3′ Reverse 5′-biotin labeled
5′ TTTTATTTTTTTTAGTTAGTTG 3′ Pyrosequencing
CpG 115 5′ GTTAGTTTGGGAGGGGGTGA 3′ Forward
5′ AAACCAAATACAAACTTACCATATCC 3′ Reverse 5′-biotin labeled
5′ GTTATGTGGGTTGAATG 3′ Pyrosequencing
KLF1 CpG 98 5′ GGTTAGGGGTTGGTGGTTGG 3′ Forward
5′ AACCCCCCCCCCTCACCTATA 3′ Reverse 5′-biotin labeled
5′ TGGGTTTAGTTTTGGTTTTA 3′ Pyrosequencing
5′ GAGGATTTAGGTGTGA 3′ Pyrosequencing
MYB CpG 216 5′ GATAGTGAGTGGGAGTTGGAGGA 3′ Forward
5′ CCATCAAACAAAAAACTTTAAACACT 3′ Reverse 5′-biotin labeled
5′ GGAGGAGAGAGAGTAGAATGGGAG 3′ Pyrosequencing
5′ GGTTTGTTTAGGAAAAGG 3′ Pyrosequencing
SIN3A CpG 401 5′ AGGGGGTGGTTTGAAAGG 3′ Forward
5′ ATATCATCCAATCCACATCCAAAA 3′ Reverse 5′-biotin labeled
5′ GGGAAAAGGAAATGTATTAG 3′ Pyrosequencing
ZBTB7A CpG 326 5′ GTAGATTTTTTTGTGTTAAGGA 3′ Forward
5′ AACAAACCCCCAACCTCTAC 3′ Reverse 5′-biotin labeled
5′ GGGATTTTTATAGTTTTATTTTTAA 3′ Pyrosequencing
5′ GGGTTTTGGTTGTATTGTATAGTTAT 3′ Forward
5′ CTCATACACTTAACCCCCAAT 3′ Reverse 5′-biotin labeled
5′ GAGGGAGAGATTAGGGTA 3′ Pyrosequencing
GATA2 CpG 515 5′ ATTGTTAGGGAGGTTTAGAGTAT 3′ Forward
5′ ACTCTCAAACCCCAAACTT 3′ Reverse 5′-biotin labeled
5′ GAGAGAGTAGGGAGGGGGT 3′ Pyrosequencing
MAP3K5 CpG 172 5′ GTGGTGGAGAGGGAGAGAGTTTGTAAG 3′ Forward
5′ CTAACCAACCACAACTCCAAACTACTCC 3′ Reverse 5′-biotin labeled
5′ GTTTTTTTTGGTTTTTTTTAGA 3′ Pyrosequencing
qPCR primer sets
HBG 5′-GAC AAG CTG CAT GTG GAT CCT-3′ Forward
5′-CCG AAA TGG ATT GCC AAA AC-3′ Reverse
ZBTB7A 5′-CAT CTG CGA GAA GGT CAT CC-3′ Forward
5′-TGT CCT GCC TGG TGA AGC-3′ Reverse
GAPDH 5′-CCA TGT TCG TCA TGG GTG TGA-3′ Forward
5′CAT GGA CTG TGG TCA TGA GT-3′ Reverse