Fig. 1From: Diversity of ATM gene variants: a population-based genome data analysis for precision medicineNovel variants predicted to lead to loss of ATM functionality. a A total of 2845 (2370 SNV and 475 INDEL) variants in the ATM gene has confirmed, including 1338 (1160 SNV and 178 INDEL) novel variants which have not yet been assigned reference SNP ID numbers. b ATM is a protein of 3056 amino acids. The phosphorylation sites (P) indicate the positions of serine residues, Ser367, Ser1893, Ser1981, and Ser2996 [6,7,8]. The NLS (~aa 385 to 388), the LZ (~aa 1216 to 1241), the FAT (~aa 1960 to 2566), the PI3-K (~aa 2712 to 2962), and the FATC ( ~aa 3024 to 3056) domains are shown in orange, light green, green, blue, and violet respectively [9]. Novel variants predicted to lead to loss of ATM functionality are indicated using red arrows: (1) stop-gained SNV, NC_000008.11:g.108115650G > A (p.Trp266*), (2) frameshift INDEL, NC_000008.11:g.108119714CAA/C (p.Glu376fs), (3) disruptive-inframe-deletion INDEL, NC_000008.11:g.108181014AAGAAAAGTATGGATGATCAAG/A (p.Ala1945_Phe1952delinsVal), (4) frameshift INDEL, NC_000008.11:g.108203577CTTATA/C (p.Ile2629fs)Back to article page