Skip to main content

Table 2 Assay details and SNP information including RFLP fragment sizes where appropriate

From: An investigation of genetic polymorphisms in heparan sulfate proteoglycan core proteins and key modification enzymes in an Australian Caucasian multiple sclerosis population

SNP numberGeneForward primersReverse primersChrChr positionAmplicon length (bp)VariationTa (°C)RFLP fragment sizes (bp)Accession numberAssay type
rs11546829EXT15’ ACAGCCCCTTCCTTACCTGT 3'5’ GGAAGTAAGGTCAGCCAAACC 3'8118847782397G/A51115, 281NT_008046.16RFLP
rs2623047SULF15’ GGGATGCACAGAAACCCTAA 3'5’ TGTGGCAAACAGTGAAGAGC 3'870378496291C/T57212, 78NT_008183.19RFLP
rs1131351SDC15’ TGCTGTACCGCATGAAGAAG 3'5’ GCTGTGGTGGAAAGGTCCTA 3'220402380354C/G62259, 94NT_015926.15RFLP
rs7333912GPC55’ GGAAACATAACAAAGTTTGCAATC 3’5’ TGGGGAGGGATAGGAAGATAAA 3’1391874131120C/G49N/ANT_009952.14HRM
rs10492503GPC55' CTTCAATACTCTTGCTTGAATCGT 3'5' CCGTAATTTGTGAGATATACCTTC 3'1392885097115A/T58N/ANT_009952.14HRM
rs9523787GPC55’ TTCCTAGTTGATTGTTGAAGAGA 3’5’ TGTAACCTTGATTTTCTTTCTAGT 3’1393363760105G/T49N/ANT_009952.14HRM
rs17267815GPC65' ATGAGAGGGCTTCCATATAATCAT 3'5' GGCAACAGTTTTGGAAGAAACA 3'1394153058129A/G58N/ANT_009952.14HRM
rs9524260GPC65’ GACAGCCAGTGAATGTAGATAGGA 3’5’ Biotin-CAAATAACAGGAAGCTCAG 3’1394513790105G/A56N/ANT_009952.14Pyro
  Sequencing primer5' CAAATAACAGGAAGCTCAG 3'        
\