Skip to main content

Table 1 Primers used in the current study

From: Novel biallelic loss-of-function variants in CEP290 cause Joubert syndrome in two siblings

Primers Forward Reversed
CEP290 SNV 5′ TAAATTCCACAGAGCCGATAAA 3′ 5′ ACAGCCCAAGAAATGAGGTT 3′
CEP290 exon 1 5′ GTTCCACGCCTTCTCATCAT 3′ 5′ TGCCAGGAGAGCCTACAGTT 3′
CEP290 exon 2 5′ AGGTGGAGCACAGTGAAAGAA 3′ 5′ TCTGCCAGTTCTTCTTGACG 3′
CEP290 exon 6 5′ AGTCTGCAGGTGGACGAGAT 3′ 5′ CCAACTCCTTTTCCATGTCC 3′
CEP290 exon 7 5′ CAGCCTAGGCGACAAAGACT 3′ 5′ CCTTTGTTGAACCACCACAA 3′
CEP290 exon 10 5′ GGACACTTATGGCTGCGTTT 3′ 5′ CATCAGTCATCTTCTCCATTTCC 3′
CEP290 exon 11 5′ CATCAGTTTGCAACAACTCTTGA 3′ 5′ TTTTGCATTGACAGCTACCAT 3′
CEP290 mRNA 5′ AAAGTTGACCCAGATGACCT 3′ 5′ AAACCGAGTATCTCGTCCAC 3′
Human GAPDH 5′ ATGTTCGTCATGGGTGTGAA 3′ 5′ GTCTTCTGGGTGGCAGTGAT 3′