Skip to main content

Table 2 List of primers used for real-time PCR to validate microarray analysis

From: Microarray analysis identification of key pathways and interaction network of differential gene expressions during osteogenic differentiation

Target gene Primer sequence Accession number Product size
GAPDH F: CTCATTTCCTGGTATGACAACGA
R: CTTCCTCTTGTGCTCTTG
NM_001357943.2 122 bp
CTNNB1 F: AATGCTTGGTTCACCAGTG
R: GGCAGTCTGTCGTAATAGCC
NM_001330729.2 176 bp
MAPK3 F: TGACCATATCTGCTACTTCCTC
R: GGTATAGCCCTTGGAGTTCAG
NM_001040056.3 250 bp
ITGAV F: GCAACAGGCAATAGAGAT
R: TGCTGAATCCTCCTTGACAA
NM_002210.5 262 bp
ITGA5 F: GCTGTGACTACTTTGCCGTG
R: CGAGTTGTTGAGATTCTTGCTG
NM_002205.5 176 bp
CCNB1 F: GCTGGGTGTAGGTCCTTG
R: CCTGCCATGTTGATCTTCG
NM_031966.4 149 bp
TLR4 F: TGATGTCTGCCTCGCGCCTG
R: AACCACCTCCACGCAGGGCT
NM_138554.5 98 bp