Skip to main content

Table 1 List of the primers

From: Screening of disease-related biomarkers related to neuropathic pain (NP) after spinal cord injury (SCI)

Primers Primer sequence (5′-3′)
GAPDH-hF TGACAACTTTGGTATCGTGGAAGG
GAPDH-hR AGGCAGGGATGATGTTCTGGAGAG
E2F1-hF CATCAGTACCTGGCCGAGAG
E2F1-hR CCCGGGGATTTCACACCTTT
MITF-hF TGAGCTTGCCATGTCCAAAC
MITF-hR ACGCTCGTGAATGTGTGTTC
CTNNA1-hF CCATGCAGGCAACATAAACTTC
CTNNA1-hR AGGGTTGTAACCTGTGTAACAAG
ADORA2B-hF TGCACTGACTTCTACGGCTG
ADORA2B-hR GGTCCCCGTGACCAAACTT
MAX-hF GAGAGCGACGAAGAGCAACC
MAX-hR GCACTTGACCTCGCCTTCT
GRIK3-hF TTCGAGGCGACCAAAAAGG
GRIK3-hR GGTTCACGTAGAAGGTGTCCT
OXTR-hF CTGCTACGGCCTTATCAGCTT
OXTR-hR CGCTCCACATCTGCACGAA