Skip to main content

Table 1 Restriction fragment length polymorphism conditions for VEGF SNPs

From: Genetic polymorphisms of Vascular Endothelial Growth Factor (VEGF) associated with endometriosis in Nigerian women

VEGF SNP Primer sequence Amplicon size Restriction enzyme Fragment lengths
 − 460 T > C
(rs833061)
TGTGCGTGTGGGGTTGAGCG (F)
TACGTGCGGACAGGGCCTGA (R)
175 bp Bsh1236I CC: 155 and 20 bp; CT: 175, 155, and 20 bp; TT: 175 bp
−1154G > A
(rs1570360)
TCCTGCTCCCTCCTCGCCAATG (F)
GGCGGGGACAGGCGAGCATC (R)
206 bp Mnl I GG: 150 bp; GA:150, 34, 22 bp; AA: 184 and 22 bp
 − 2578C > A
(rs699947)
GGATGGGGCTGACTAGGTAAGC (F)
AGCCCCCTTTTCCTCCAAC (R)
324 bp Bgl II CC: 324 bp; CA: 324, 202, and 122 bp; AA: 202 and 122 bp
 + 936C > T rs3025039 AAGGAAGAGGAGACTCTGCGC (F)
TATGTGGGTGGGTGTGTCTACAG (R)
198 bp Hsp92II CC: 198 bp; CT: 198, 112 and 86 bp; TT: 112 and 86 bp