Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences for real-time PCR

From: Downregulation of miR-542-3p promotes osteogenic transition of vascular smooth muscle cells in the aging rat by targeting BMP7

Genes5′-3′PrimersProduct
Size (bp)
Reference sequence
SM 22αForward
Reverse
CCCGCCCTCCATGGTCTTCAAG
GCCAAACTGCCCAAAGCCATTAC
165NM_031549.1
CalponinForward
Reverse
CGGGCACCAAGCGGCAGATCT
CCGGGGTCAGGCAGTACTTGGGA
165NM_031747.1
OPNForward
Reverse
CATCAGAGCCACGAGTTTCA
TCAGGGCCCAAAACACTATC
274NM_012881.2
Runx2Forward
Reverse
CAGACCAGCAGCACTCCATA
CAGCGTCAACACCATCATTC
178NM_001278483.1
GAPDHForward
Reverse
AAGTTCAACGGCACAGTCAAGG
CGCCAGTAGACTCCACGACATA
139NM_017008.4