Fig. 1
From: Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families
The pedigrees and molecular analysis of the two novel deletion mutations. a The pedigree of family A. The proband was labeled with black arrow. b Sanger sequencing of the deletion HBB: c.180delG in the proband in family A. c The β-globin peptide structure predicted by Swiss-Model. WT, wild type. d The pedigree of family B. e Sanger sequencing of the deletion HBB: c.382_402del CAGGCTGCCTATCAGAAAGTG in the proband in family B. f The β-globin peptide structure predicted by Swiss-Model. The different domain between WT and the deletions was labeled by red arrow